Shahrukh Khan - the Living Legend free essay sample

His eighth Filmfare Best Actor Award win made him the most awarded Bollywood actor of all time in that category, tied only with actor Dilip Kumar. In 2005, the Government of India honoured him with the Padma Shri for his contributions towards Indian cinema. After graduating with a bachelors degree in economics, he started his career appearing in theatre and several television serials in the late 1980s and later made his Hindi film debut in 1992 with Deewana. Early in his career, Khan was recognised for his unconventional choice of portraying negative roles in films such as Darr (1993), Baazigar (1993), and Anjaam (1994). He later rose to prominence by playing a series of romantic roles in the films Dilwale Dulhaniya Le Jayenge (1995). ,[8] Dil To Pagal Hai (1997), and Kuch Kuch Hota Hai (1998). [9] The commercial success of these films earned him the tag of the King of Romance. [8] Khan then subsequently earned wide critical appreciation for his portrayal of a NASA scientist in Swades (2004), a hockey coach in Chak De! India (2007), and as the titular character in My Name Is Khan (2010). We will write a custom essay sample on Shahrukh Khan the Living Legend or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page 10][11] 12 of the films he has acted in, have accumulated gross earnings of over 100 crore (US$18 million) worldwide,[12][13] making him one of the most successful leading actors of Hindi cinema. [14] Khan is the co-founder of Dreamz Unlimited, a production company and occupies the position of co-chairman of the motion picture production and distribution company Red Chillies Entertainment and the animation studio Red Chillies VFX. He is also co-owner of the Indian Premier League cricket team Kolkata Knight Riders. [15] The year 2007 marked his debut as a television presenter with the Star Plus gaming show Kaun Banega Crorepati. 16] Khan is often labelled by the Media as Brand SRK due to his various brand endorsement and entrepreneurship ventures. He is also a regular stage performer and award ceremony host and has been involved in philanthropic endeavors related to Health care, relief funds and childrens education, for which he was honoured with the UNESCOs Pyramide con Marni award in 2011. [17][18] Khan is considered to be one of the biggest film stars in cinematic history, with a fan following claimed to number in the billions; in 2011, the Los Angeles Times called him the worlds biggest movie star. [19] He has also been regularly featured in the listing of the most powerful names in Indian Cinema and in 2008, Newsweek named him one of the 50 most powerful people in the world. [5] Khan has an estimated net worth of over US $600 million(25 bi llion). [20][21][22][23] He has been married to Indian film producer and interior designer, Gauri Khan since 1991, and together they have two children. Contents [hide] 1 Early life and background 2 Acting career 2. 1 1988–92: Early work and breakthrough 2. 2 1993–97: Critical and commercial success 2. 3 1998–2002: International recognition 2. 4 2003: Spine injury and subsequent surgery . 5 2003–10: Stardom and critical acclaim 2. 6 2011–present: Continuing other ventures 3 Producer 4 Philanthropy 5 Non-film work 5. 1 Television presenting 5. 2 Stage performances 5. 3 Brand SRK 5. 4 Ownership of IPL cricket team 6 Public image 7 In popular media 8 Acting style and analysis 9 Filmography 10 See also 11 Notes 12 Bibliography 13 External links Early life and background Khan was born on 2 November 1965 to Muslim parents in New Delhi, India. [24][25] His father, Taj Mohammed Khan, a Pathan, was an Indian independence activist from Peshawar, British India , present day Pakistan. According to Khan, his paternal grandfather was originally from Afghanistan. [26] His mother, Lateef Fatima, was the adopted daughter of Major General Shah Nawaz Khan of the Janjua Rajput clan, who served in the Indian National Army. [27] Khans father came to New Delhi from Qissa Khawani Bazaar in Peshawar before the partition of India,[28] Regarding his origins, he described himself on Twitter as half hyderabadi (mom) half Pathan (Dad) some kashmiri (grandmom)[29] His father died from cancer when Khan was 15 years old, and his mother died in 1990 after prolonged illness. 30][31] Khan was very attached to his parents as a child and describes their early deaths as a turning point in his life and as his biggest motivation for hard work. He explained that his ideology in life is to make movies so damn bloody big that my parents somewhere sit down on a star and from there also can look at their son and say I can see his movies from here better than I can see the Wall of China or anythin g. We see his movies covering the face of this earth. [32] Khan has an elder sister named Shehnaz. [33] Growing up in Rajendra Nagar neighbourhood of Delhi,[34] Khan attended St. Columbas School where he was accomplished in sports, drama, and academics. He won the Sword of Honour, an annual award given to the student who best represents the spirit of the school. Khan later attended the Hansraj College (1985–1988) and earned his Bachelors degree in Economics. When Hansraj College celebrated its 50th anniversary, it gave away 17 shields to its alumni who had excelled in their lives and professions. Khan was one of them. Though he pursued a Masters Degree in Mass Communications at Jamia Millia Islamia, he later opted out to pursue a career in Bollywood. 35] He also attended the National School of Drama in Delhi. [36] After the death of his mother, Khan moved to Mumbai in 1991. [37] He married Gauri Chibber, a Hindu, in a traditional Hindu wedding ceremony on 25 October 1991. [30] They have two children, son Aryan (b. 1997) and daughter Suhana (b. 2000). According to Khan, while he strongly believes in Islam, he also values his wifes religion. At home, his children follow both religions, with the Quran being situated next to the Hindu deities. [38] Acting career See also: Shahrukh Khan filmography 1988–92: Early work and breakthrough Khan studied acting under the mentorship of theatre director Barry John at Delhis Theatre Action Group (TAG). [39] Khans first starring role was in Lekh Tandons television series Dil Dariya, but due to production delays, the 1988 television series, Fauji was his television debut. He played the leading role of Commando Abhimanyu Rai in the critically acclaimed show, which earned him mass recognition. [37][40] He went on to appear in Aziz Mirzas Circus (1989)[41] and played a minor role in the made-for-television English-language film, In Which Annie Gives It Those Ones (1989). His appearance in these teleserials, led critics to compare his acting style with that of film actor Dilip Kumar. [42] In 1991, Khan shifted base to Mumbai and received his first film offer with Hema Malinis directorial debut Dil Aashna Hai. [37] However, due to production delays, his second film, Deewana (1992), alongside Rishi Kapoor and Divya Bharti released first. [36][43] The film became a box office hit, and launched his career in Bollywood. [44] Despite portraying a supporting character in the film, he won a Filmfare Best Male Debut Award, the following year. He subsequently featured in Mani Kauls adaptation of Fyodor Dostoevskys The Idiot, Idiot. Originally made for television, the film eventually received a theatrical release and debuted at the New York Film Festival on 8 October 1992. [45] Later that year, he played the titular character in the comedy, Raju Ban Gaya Gentleman, which was his first of many collaborations with actress Juhi Chawla. The film proved to be a box office hit. [46] He went on to star in Ketan Mehtas Maya Memsaab, an adaptation of Gustave Flauberts novel Madame Bovary. Upon release, the film generated controversy in India due to Khans appearance in an explicit sex scene with co-star Deepa Sahi. [47] 1993–97: Critical and commercial success In 1993, Khan garnered appreciation for portraying negative roles, that of an obsessive lover and a murderer, respectively, in the box office hits, Darr and Baazigar. [48] The Encyclopedia of Hindi Cinema analyzed that he defied the image of the conventional hero in both these films and created his own version of the revisionist hero. [49] Darr marked the first of many collaborations of Khan with film-maker Yash Chopra and his banner Yash Raj Films. Khans stammering in the film and the usage of the phrase, I love you, Kkkiran, were popular with the audiences. [50] His other release, Baazigar, in which he played an ambiguous avenger who murders his girlfriend, shocked the Indian audiences with an unexpected violation of the standard Bollywood formula. [51] His performance in Baazigar won him his first Filmf are Best Actor Award. The same year, Khan played the role of a love-struck musician in Kundan Shahs dramedy Kabhi Haan Kabhi Naa, a performance that earned him a Filmfare Critics Award for Best Performance. In a retrospective review by Rediff, Sukanya Verma called it Khans best performance and added, He was spontaneous, vulnerable, boyish, mischievous and acting straight from the heart. [52] Khan, himself, considers this film to the best film that he has acted in. [53] In 1994, Khan once again played an obsessive lover in Anjaam, co-starring Madhuri Dixit. Though the film was a commercial failiure, Khans performance earned him the Filmfare Best Villain Award. [54] Khan, holding a painting of his character Raj Malhotra from Dilwale Dulhania Le Jayenge(1995) that was gifted to him during an appearance on a TV show. In 1995, Khan starred in two box-office blockbusters. His first release was Rakesh Roshans melodramatic thriller Karan Arjun, in which Khan was a part of an ensemble cast that included Salman Khan, Kajol, Mamta Kulkarni, Raakhee and Amrish Puri. The film, which dealt with the concept of reincarnation, became the second-highest grossing film of the year in India. 55] He followed it with Aditya Chopras directorial debut, the romance Dilwale Dulhania Le Jayenge. A major critical and commercial success, the film became the years top-grossing production in India and abroad. [56] The film was declared an all time blockbuster; it remains the longest-running film in the history of Indian cinema[57] and as of 2011, it is still playing at the Maratha Mandir theatre in Mumbai. [58] Dilwale Dulhania Le Jayenge has grossed over 1. 2 billion worldwide. The film won ten Filmfare Awards, and Khans performance as a young NRI who alls for Kajols character while on a trip across Europe won him critical acclaim and his second Best Actor Award at the Filmfare. In 2005, Indiatimes Movies ranked the film amongst the 25 Must See Bollywood Films, citing it as a trendsetter of sorts. [59] Raja Sen reviewed, Khan gives a fabulous performance, redefining the lover for the 1990s with great panache. Hes cool and flippant, but sincere enough to appeal to the junta [audience]. The performance itself is, like the best in the business, played well enough to come across as effortless, as non-acting. [60] 1996 proved to be a disappointing year for Khan, as he appeared in two critical and commercial failiures, Praveen Nischols English Babu Desi Mem and Mahesh Bhatt Chaahat[61] However, in 1997, his starring role in Subhash Ghais social dram a Pardes earned him commercial success. The film, which also featured Mahima Chaudhry and Apurva Agnihotri, saw him portray the role of Arjun, a musician facing a moral dilemma. His performance earned him a nomination for the Best Actor at the Filmfare Award ceremony. He then featured in Aziz Mirzas romantic comedy, Yes Boss, opposite Juhi Chawla. Upon release, the film performed moderately well at the box-office. [62] His final release of the year was Yash Chopras blockbuster musical romanance, Dil to Pagal Hai. The project, also featuring Madhuri Dixit and Karishma Kapoor, marked his second collaboration with the filmmaker. Khan essayed the role of Rahul, a stage director who falls in love with one of his new actresses, played by Dixit. The film as well as his performance met with critical appreciation; he won his third Best Actor Award at the Filmfare. [62] 1998–2002: International recognition In 1998, Khan appeared in three films. His first release was Mahesh Bhatts action comedy, Duplicate opposite Juhi Chawla and Sonali Bendre. The film, which saw him portray a double role, marked his first of many collaborations with Yash Johars production company, Dharma Productions. The film however, failed to do well at the box office. [63] He then won critical praise for his performance in Mani Ratnams acclaimed Dil Se The film was the third in Ratnams trilogy of terror films that depict human relationships against a background of Indian politics, after Roja (1992) and Bombay (1995). 64][65] Khan played the part of Amarkant Amar Varma, an All India Radio correspondent, who develops an infatuation for a mysterious terrorist, played by Manisha Koirala. [66] Rediff. com published, Khan delivers a compelling performance. He plays the part with taut restraint, and expresses exasperation superbly. [67] The film,which failed financially in India, however, emerged as a commercial success overseas,[68] becoming the first Indian film to enter the top 10 at the United Kingdom box office. [69][70] His final release of the year was Karan Johars candyfloss romance, Kuch Kuch Hota Hai, which paired him with Kajol and Rani Mukerji. The film was declared an all time blockbuster, with a worldwide gross of over 1 billion. [71] Khan played the role of Rahul Khanna, a college student, who falls in love with his best friend, Anjali(Kajol) after the death of his wife, Tina( Rani Mukerji), years after breaking contact with her. His performance won him the Best Actor award at the Filmfare ceremony for the second consecutive year. Khans only release in 1999, Baadshah opposite Twinkle Khanna, was an average grosser, for which he earned a Filmfare Award nomination for Best Performance in a Comic Role. 72] In the same year, Khan set up his own production company, Dreamz Unlimited with actor, Juhi Chawla and director, Aziz Mirza. (see below). In 2000, the three collaborated on their first film, Phir Bhi Dil Hai Hindustani. The film opened to mixed reviews from critics and audiences alike and failed to emulate the commercial success of the trios previous films, Raju Ban Gaya Gentleman and Yes Boss. [73] Khans next release was Mansoor Khans action drama Josh. The film starred Khan as the leader of a Christian gang in Goa, with Aishwarya Rai playing his twin sister. The film emerged as a box office success in both India and abroad. [73] Vinayak Chakravorty of Hindustan Times wrote that Khan basks in his tailormade role, donning with panache the garb of a streetsmart tough. [74] He next played the role of a Muslim archaeologist, beaten to death during the unrest following the partition of India in Hey Ram. Directed by and co-starring Kamal Hassan, the film was critically acclaimed and was selected as Indias entry for the Best Foreign Language Film at the Oscars that year. [75] Additionally, for the Tamil version of the film, Khan dubbed for his own lines. 76] His final release of the year was Aditya Chopras romantic drama, Mohabbatein, co-starring Amitabh Bachchan. The film was a major financial success, and Khans performance as a music teacher was acclaimed by critics; Taran Adarsh of Bollywood Hungama mentioned him to be outstanding as Raj Aryan. He was awarded his second Filmfare Critics Award for Best Actor for his performance in the film. I n 2001, Khan produced and essayed the titular role in Santosh Sivans historical epic, Asoka, a partly fictionalised account of the life of Ashoka the Great. 77] The film was screened at the Venice Film Festival and the 2001 Toronto International Film Festival to a positive response. [78] The film, which also featured Kareena Kapoor received generally positive reviews with Khan receiving favourable reactions for his performance; Rediff concluded that he puts in a strong performance, in this well defined role. [79] He next collaborated with Karan Johar again in the family drama, Kabhi Khushi Kabhie Gham, in which he featured as a part of an ensemble cast that included Amitabh Bachchan, Jaya Bachchan, Kajol, Kareena Kapoor and Hrithik Roshan. The film was a major financial success in India and the top-grossing Indian production of all-time in the overseas market until 2006, earning over 1. 17 billion worldwide. [80] Khans portrayal of Rahul Raichand, an adopted son of Bachchans character, who disowns him for marrying a girl belonging to a lower socio-economic group than his family, played by Kajol, met with wide public appreciation. Khan described the character of Rahul by saying, I love the vulnerability and the honesty in his eyes. He has the appeal of a boy next door. Besides, his intensity and ability to convey emotions without words is amazing. [81] Taran Adarsh reviewed, Khan sparkles yet again, noting that he performed the part with amazing poise, class, honesty and maturity. [82] It garnered him another nomination for the Filmfare Best Actor Award. Khan termed Kabhi Khushi Kabhie Gham as a turning point in his career. [81] In 2002, Khan played the titlular role, The role of Devdas in Sanjay Leela Bhansalis period romance, Devdas, which was the most expensive Bollywood film ever made at the ti

Free Essays on Effects of Trust in Management

Introduction A few weeks ago, I was watching the evening news with a friend of mine. A breaking story came on announcing Arthur Anderson’s use of unethical accounting practices in the Enron scandal. I asked Shannon if she knew anything about the firm’s involvement, and she said in disbelief that she had not. The interesting fact here is that Shannon works for Anderson Consulting. In that moment, she lost all trust in the company and is now looking for a new job. Trust plays a pivotal role in every corporation’s daily activities; it can be a specific management tactic, or a mediating variable in a work team. Increased trust between managers and subordinates will lead to increased productivity and job commitment. However, this type of persuasive discourse is often very difficult to consciously achieve because of the numerous factors involved. This paper will address contemporary ideas on establishing trust in organizations, its effects and includes an informal study on the use of managerial trust. Literature Review Over the past few years, the topic of trust in management has received much scholarly attention. The fall of Enron and other such recent scandals where hundreds of employees lost their jobs may explain this. As Caudron (1996) explains it, â€Å"Management has lost all credibility, employees are scared, and organizational trust has hit rock bottom.† An article by Ellen Whitener et al. (1998) explores the many practices managers must engage in to gain employee trust. She begins by defining managerial trust in three facets. First, trust relies on the trustor’s belief that the trustee will act benevolently. Second, trust relies on the concept that risk is involved. Third, there is some degree of dependency in the relationship (Whitener, p. 513). Here, trust is viewed as an attitude the trustor has about the trustee. Whitener uses two theories to analyze the motivation behind trust strategies, agen... Free Essays on Effects of Trust in Management Free Essays on Effects of Trust in Management Introduction A few weeks ago, I was watching the evening news with a friend of mine. A breaking story came on announcing Arthur Anderson’s use of unethical accounting practices in the Enron scandal. I asked Shannon if she knew anything about the firm’s involvement, and she said in disbelief that she had not. The interesting fact here is that Shannon works for Anderson Consulting. In that moment, she lost all trust in the company and is now looking for a new job. Trust plays a pivotal role in every corporation’s daily activities; it can be a specific management tactic, or a mediating variable in a work team. Increased trust between managers and subordinates will lead to increased productivity and job commitment. However, this type of persuasive discourse is often very difficult to consciously achieve because of the numerous factors involved. This paper will address contemporary ideas on establishing trust in organizations, its effects and includes an informal study on the use of managerial trust. Literature Review Over the past few years, the topic of trust in management has received much scholarly attention. The fall of Enron and other such recent scandals where hundreds of employees lost their jobs may explain this. As Caudron (1996) explains it, â€Å"Management has lost all credibility, employees are scared, and organizational trust has hit rock bottom.† An article by Ellen Whitener et al. (1998) explores the many practices managers must engage in to gain employee trust. She begins by defining managerial trust in three facets. First, trust relies on the trustor’s belief that the trustee will act benevolently. Second, trust relies on the concept that risk is involved. Third, there is some degree of dependency in the relationship (Whitener, p. 513). Here, trust is viewed as an attitude the trustor has about the trustee. Whitener uses two theories to analyze the motivation behind trust strategies, agen...

Understanding Practical Business and Organizational Research Assignment

Understanding Practical Business and Organizational Research - Assignment Example The study elucidates the huge problem of poor performance, accountability, and transparency in the government institutions such as municipalities. The Americans have expressed their dissatisfaction of the delivery of services in the government institutions. On the other hand, the purpose of the study was to evaluate the contribution of performance measure to the sustainable improvement, accountability, and transparency of the government organization (Sanger, 2012). The research hypothesized that cities that had sophisticated performance measurement systems would have a high likelihood of using the performance data to improve performance. However, the research did not have research questions. The study used an analytic approach to collect quantitative data from a sample of 190 cities. The researchers searched the cities with a high likelihood of measuring performance with the intent of improving service delivery (Sanger, 2012). Fundamentally, the researchers selected a sample from four service areas namely police, parks and recreation, fire, and public works. The study used quantitative approaches to analyze the data and present it in tables. The study findings are important for the city mayors and officials who hold leadership positions to implement the information gotten from performance measurement for the betterment of services. In summary, the researchers established that government institutions rarely implement the information from performance measurements for the improvement of services. The data analysis indicates that few organizations use the information to improve service delivery. The analytic approach used in this study can be applied to solve performance problems. The researchers have analyzed the problem by seeking the primary data of the various cities. Primary data establishes the main cause of a problem, and thus provides a platform for selecting the best solution (Zikmund, 2013). For

John Wycliff's contribtions to the christian religion Term Paper

John Wycliff's contribtions to the christian religion - Term Paper Example Other individuals believed in giving out offerings so that they can receive forgiveness for their sins (McDonald 139). John Wycliffe acquired his college education at Morten College at Oxford, which acted as a fundamental tool in his career. This is becoming a significant and reputable icon towards building Christian faith. During Wycliffe’s time, the church had a dominant force in almost all areas of life. The church utilized its power to exploit fellow Christians in a variety of ways. For instance, Christians were to pay for their sins whereby mode of payment was money or gifts meant for the ministers (Phillips 26). Most people were in bondage of the church and its sacraments based on how it expressed and ensured its power manipulated Christians. This prompted Wycliffe turned out to be the then fearless critical of the church’s abuse of power (Davis 98). Hence, becoming popular due to his stern stand and criticism on the church though he based his arguments on the word. The then secular government was an example of a reputable organization that boosted and sided with him in its quest to reveal how the church had become and taken advantage of its congregation’s ignorance. Government’s support was in form of preventing the church from directly condemning the emergent critic whose arguments were justifiable besides the church some of the dealings being unbiblical. Wycliffe was also a significant workforce in the reformation of the church. During his time, the church seemed own a large area of England besides having an unconquerable influence (Lavinsky). Instances of corruption characterized the mainstream church more so the clergy taking advantage of the ignorant faithful. In addition, the clergy contrary to what their vows stated proved to be immoral besides sometimes allowed to pass certain stages without accomplishing the required measures, hence the church during then producing illiterate priests (McDonald

Urban Studies and Planning Essay Example | Topics and Well Written Essays - 1000 words

Urban Studies and Planning - Essay Example All these careers are exciting and personally fulfilling in the sense that they are well paying, challenging, and they give one an opportunity to grow. The urge of using my skills to establish a community where people can live and start families makes a career as an urban planner to be my first priority. I understand that a college degree in addition to extensive training is a requirement for a successful entry into this field of work. To qualify as an urban planner, one needs to take classes on environmental studies so as to understand the interactions between people and the natural environment as well as the dynamics of the environment. Moreover, a person needs to take classes on economics so as to comprehend how the markets operate, particularly, what makes a successful regional economy and business. Additionally, one needs to take classes in art and design so as to prepare oneself to think creatively about visual appearances. The prospect of getting employed as an urban planner is also high. First, there are many institutions, both public and private that hire urban planners. With a degree in urban planning together with the required experience, I can be hired by local/regional governments, private planning firms, and private property owners to facilitate the planning of commercial and communal developments, as well as transportation systems and public facilities (Bayer, Frank, & Valerius, 2009). Secondly, urba n planning is a growing field of employment. As Bayer, Frank & Valerius (2009) put it, the roles of urban planners remain in high demand, and is expected to grow significantly by 2014. For example, the U.S News and Urban Report rated urban and regional planner among the best careers in 2009 (U.S News, 2009). Additionally, the Bureau of Labor Statistics projects a 15% growth in planning jobs between 2006 and 2016. The salary and benefits of regional and urban planners is very attractive. The Bureau of Labor Statistics indicates that the median yearly pay for urban and regional planners was $63,040 in May 2010 (Bureau of Labor Statistics, 2013). Based on the fact that the planning industry has experienced growth in the past years, the prospect of career development is also looking good. This growth is stimulated by environmental concerns and population growth being experienced. Other than becoming an urban planner, I would prefer to become an architect. Since my childhood, I have alwa ys been fascinated with the science and art of building and construction. The prospect of becoming a renowned architect is exciting and interesting because this career path will enable me to design an entire built environment- from how a building associates with its surrounding environment, to construction or architectural details that entails its interior and designing and making furniture to be used inside it. Looking at this career path from a different perspective, I established that architecture is poetic in the manner that it presents itself. It is complex in the questions and issues it gives rise to. Contrary to popular belief that architecture is static, I have established that architecture is detailed and analytical. These qualities make this career path not only attractive, but also fulfilling. A career in architecture is interesting and exciting due to its longevity nature. As compared to most professions, architects can practice their

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

United States Involvement in The Second World War (WWII) Essay

World War II   Ã‚  Ã‚  Ã‚  Ã‚  As totalitarian sates emerged into power, the United States got involved with World War II to help control these groups and to promote democracy in the European theatre of the world. The party with the most power at the time was the Nazi Party, led by Adolf Hitler. This socialist party was led by a powerful dictator who broke away from the League of Nations and began to conquer vast amounts of territory at a fast rate. The United States wanted to leave foreign affairs alone in fear of another world war. The United States could not avoid the fact Hitler was taking over Europe and help was needed. The United States became fully involved in the European theatre of World War II when Hitler led his armies on a series of blitzkrieg’s, taking over Denmark, Norway, Belgium, Holland, northern France, and by breaking the Nazi-Soviet pact.   Ã‚  Ã‚  Ã‚  Ã‚  The United States, under the presidency of Franklin D. Roosevelt, wanted to remain neutral and wanted to stay out of foreign affairs. People like Lindbergh strongly opposed any aid to foreign affairs, but Roosevelt felt American security and Democracy was in jeopardy if no help was given. As Hitler began his campaigns in Europe, especially in Poland, the United States sent aid to France and Britain to resist the Nazi’s. Germany defeated Poland and easily took over weaker countries, sometimes without Keith 2 firing a single shot as in Czechoslovakia. The United States remained...