Monday, December 30, 2019

It s Not Rape If You Sing It - 2854 Words

Joel Johnson It’s Not Rape if You Sing It: Animals The Music Video a refreshing portrayal of American culture. The pop rock band Maroon 5’s new hit single Animals from their fifth studio album V is their 10th song to reach the top 10 on the Billboard Hot 100 chart. At first glance it appears to be just another unoriginal pop rock song; melodic, repetitive. But as we look at the press that surrounds both the song and its music video we find a controversy surrounding sexual violence and objectification. There can be no question of a need of such discussion in regards to the themes that Animals the music video brings to light. That being said, the question in this discussion should not be whether it promotes these topics but rather if it does a good enough job of making the audience critically aware that these problems exist. This will be done by looking at the video and its song from a radical Feminist perspective. Bell Hooks defines Feminism as, â€Å" a movement to end sexism, sexist exploitation, and oppression. A nd the first step of ending these things is showing how they are a part of our culture which this video does brillintly. The music video is clearly, rather than promoting rape culture, is not only a sardonic view of the song lyrics themselves and the meaning behind them but also critiquing the hegemony of the sexually violent culture we live in today. In this paper I would like to analyze the music video Animals by Maroon 5 from two different angles. The firstShow MoreRelatedThe Song Released By R B Singer1747 Words   |  7 Pagesout random props. The models occasionally stare at the camera while Thicke sexually sings the lyrics in their ears. These scenes repeat throughout most of the video while it ends with the phrase â€Å"#Thicke† in big, bold letters on the screen. In â€Å"Blurred Lines†, the sexual song lyrics as well as the explicit scenes in the music video relies on sexist gender schemas that subordinate women to men while reinforcing rape culture, the o bjectification of women, and the social status of men versus women. Read MoreRape Culture Controversy Essay896 Words   |  4 Pagesback of my mind for quite some time: rape culture. This issue is vastly popular in the world of bloggers and social networking site, tumblr. It’s slowly progressing into an important issue that the public is acknowledging. Reviewing the issue’s historical, social, political, cultural and economic perspectives will entail rape culture’s controversy. Rape culture is an issue that has gained moment through the feminist movement within the last couple of decades. Rape itself has been around since the beginningRead MoreTo Kill a Mockingbird by Harper Lee1197 Words   |  5 Pages The Innocence Within Thoughts are like seeds that take root in our minds. They spawn feelings and more thoughts that can have powerful consequences. In the novel, To Kill a Mockingbird, by Harper Lee, the views of the townspeople in the 1930’s Southern town of Maycomb greatly impact the lives of two innocent men. The people make false accusations against Tom Robinson and Arthur â€Å"Boo† Radley because they are different. These characters are representative of the author’s reoccurring symbol ofRead MoreTristan Hanna. Mrs.Jenkins. English 1. 21 February2017.757 Words   |  4 Pages2017 Evils of Racism: 1930 Have you ever wondered what it was like to live in a racist society in the 1930 as a 6 year old. In Harper Lee’s epic novel To Kill a Mockingbird, it takes place in Alabama during the Depression, and is narrated by the main character, a little girl named Jean Louise Scout Finch. Her father, Atticus Finch, is a lawyer with high moral standards.The most prevalent theme is the evils of racism. One example is Mrs. Dubose s comments to Scout and Jem as they passRead MoreConnie Francis Essay699 Words   |  3 PagesWelcome to an era filled with sock-hops, diners, and poodle skirts. But thats not all! Arguably the most important aspect of the 1950s was that it was also a time filled with the newly evolved genre of rock n roll, a type of music that resulted from a combination of rhythm and blues, gospel music, country, and jazz. Rock and roll completely revolutionized musical tastes and essentially changed the world, especially among the youth. Suddenly all across the nation, teenagers were able to listenRead MoreEssay about Maya Angelou682 Words   |  3 Pagesautobiographical books focusing on her childhood until the birth of her own child, ten of which have appeared on the best selling list (â€Å"Biography† 1). The most prestigious of the novels is I Know Why the Caged Bird Sings. This is a very controversial novel dealing with many serious issues including rape and murder. It is her most critically acclaimed work and was nominated for the National Book Award (â€Å"Maya American† 1). She often writes using a female as the strong role model. In addition, she has publishedRead MoreThe Bluest Eye By Toni Morrison1561 Words   |  7 Pagesbegins with Beloved being introduced â€Å"124 was spiteful. Full of a baby s venom† The novel also has some biblical references not sure if that’s what Toni Morrison intended but there are biblical allusions in Beloved . Paul is himself appropriating the words of the prophet Hosea here: â€Å"V’amarti l’lo-ami ami-atah v’hi yomar elohai—And I will say to them that were not my people, you are my people, and they shall say, you are my God† (225) . This quotes also illustrates that formerRead MoreHorses Of God : Masculinity1611 Words   |  7 Pagesother boys, and, is ultimately unable to defend himself as he gets pushed around. Hamid is able to stop the fight by stepping in and whipping the boy who pushed Tarek with a chain while screaming, â€Å"Touch my brother again and I’ll beat the shit out of you!† Hamid is much more combative and threatening than his younger brother, and performs his masculinity in a way that violently affects the other boys, who flee from the scene as Hamid continues to strike at them with his chain. By running away, the otherRead MoreEmma Eichinger. Mr. Rankins. English 2 Unit 9. 7 March1181 Words   |  5 PagesEmma Eichinger Mr. Rankins English 2 Unit 9 7 March 2017 Jim Crow Laws- What They Are And Their Effects â€Å"Come listen all you galls and boys I’s jist from Tuckyhoe, I–m going to sing a little song, my name’s Jim Crow, Weel about and turn about and do jis so, Eb–ry time I weel about I jump Jim Crow.† Thomas â€Å"Daddy† Rice, a popular white entertainer during the 1800’s, foolishly pranced around while singing this tune, aptly titled â€Å"Jump Jim Crow†, imitating African American plantation workers in a derogatoryRead Moreâ€Å"Shoot All The Blue Jays If You Want, If You Can Hit’Em,1224 Words   |  5 Pagesâ€Å"Shoot all the blue jays if you want, if you can hit’em, but remember it’s a sin to kill a mockingbird,† ( Lee pg 90) In Harper Lee’s famous novel, To Kill A Mockingbird, the author emphasizes the major issue of justice representing the symbol of a mockingbird. Taking place in the 1930s in the Deep South, a time when racial inequality and great intolerance were highly prevalent . The novel comes out as an injustice to the most gracious and thoughtful but unjustly accused citizens from the town

Sunday, December 22, 2019

Is Rehabilitative Programs Really Helpful Reducing...

When one is released from prison how many resources are being provided to them in order to help them to succeed and do better? Are rehabilitative programs really helpful in reducing recidivism for both men and women? These are serious questions and somewhat considered problems in the criminal justice system. There are many programs in the world that offer help to offenders and prisoners so that when they are released they will know what to do in order to change their lives around and do better. To prepare inmates for their release back into society and to reduce recidivism, inmates are given open doors while detained to learn health care ideas and work abilities. In many correctional facilities they offer many different classes such as†¦show more content†¦It helps one to get on her feet and gain her family and children back, while reducing recidivism at the same time. In one article that I read called â€Å"The oxford Handbook of sentencing and corrections† it studie d the effectiveness of correction-based work and academic and vocational education programs. A large number of offenders participate in these type of programs while incarcerated or even when released from prison. It is believed that â€Å"education programs include many of the components of effective correctional treatment.† (joanpetersilia and kevin R. Reitz,2012.The oxford handbook of sentencing and corrections Retrieved from www.reentryeducationnetwork.org../the effectivness petesilia.pdf Research conducted from the article â€Å"Analyzing the effectiveness of rehabilitation programs that were to be successful: academiceducation, vocational education, MRT (moral recognition therapy) behavioral treatment for sex offenders, drug courts and more. Cognitive behavioral treatment is another treatment used which I wanted to research and find out more about it. In the book Cognitive behavioral Treatment† there is a chapter: the increasing need for effective treatment services. The author believed that â€Å"in 2000, 502,000 offenders were released form correctional facilities in the U.S. and the release estimate for 2004 is more than 600,000†.(Bureau of justice statistics,n.d, pertersilia,2004) Due to an

Saturday, December 14, 2019

Ethical Issues with the Software Piracy Issue Free Essays

Computer ethics deals with moral responsibility of what is wrong and right. Based on ? Importance of Computer Ethics and Software Piracy? article, software piracy is copying, distributing, and using software or games without paying. Software Piracy is a form of ethical issue that is hard to solve in society, especially among students of Faculty of Computer Science University of Indonesia. We will write a custom essay sample on Ethical Issues with the Software Piracy Issue or any similar topic only for you Order Now Based on writer observation in campus, students are still using pirated software, including using, duplicating, and distributing it to their friends. This attitude of course violates developer’s intellectual property. The article also mentions about intellectual property and penalties for those who violate computer ethics laws. Intellectual property is including images, patents, procedures, videos, audios, and drawings. For those who violate someone’s intellectual property will be given penalties—paying hefty fines to extensive prison time. But even so, it seems the penalties are still blurring for students. Nowadays, information technology has widely grow and used by human. Computer technology, both hardware and software has been widely approved as an intellectual property. The fast growth of technology innovation, especially software, is open for public and can be easily accessed by public via internet. It is the same for software piracy. Serial key, hack-version, and more other ways are easily accessible and widely available. Based on ? Ethical Issues in Software Piracy? article, someone should have a moral responsibility in using software. So, from internal-self of user should be aware of someone’s intellectual property. W. D. Ross stated ? The Right and the Good? as our guideline to prove our moral responsibility toward software and/or its developer. Software piracy would cause loss of revenue for the developer. Thus, it will decrease developer’s motivation in designing new software. Impacts of software piracy explained above are mostly occurred because of human and economic factor. Based on the article, software piracy occurred mostly in developing-countries; because of their low economics (from GDP per capita), they find it harder to purchase software. Indonesia is one of developing-countries, so it can be concluded roughly that Indonesian people hard to pay for software. In smaller scale, Indonesian social levels have a representative number of users in technology. Social level is about divided in three level; low, medium, and high class. In Faculty of Computers and Society, students also varied in social level or economic level. Some students have Iphone, Windows Phone, or tablets, but some don’t. In general, there is no difference among those levels. Every student is using technology. But in majority, students didn’t put much attention toward software piracy issues. Those who have laptops may prefer using unlicensed operating system than using open source operating system. It is a form of software piracy—using without paying. In addition, current status of our community is still far from the word ? ethical?. We have not appreciating others’ property as well as we did to ourselves yet. The rule in ? Kode Etik Mahasiswa Fasilkom? , point two stated ? †¦including appreciates intellectual property?. Students of Faculty of Computer Science already know about this rule. In fact, it’s not the same as in the implementation, ignorance being a common habit. Ignorance regarding unlicensed software caused software piracy. Majority tend to have neither attention nor self-control in using unlicensed software. Some may didn’t know that it is unethical. But some maybe already know that what he/she doing is wrong, but even so he/she is still doing it just because everybody—community—is doing it. Our community is affecting us. A student may be an example for his/her friends or his/her community. He/she may use unlicensed software that is followed by others. This ignorance habit can damage our own personal ethical which embedded in our heart. Furthermore, we start believing that our wrong-doing is right. In analyzing software piracy, writer think students should have an awareness and moral responsibility. A developer of software may not know that his/her intellectual property was just being used irresponsibly. Student of Faculty of Computer Science should have known how hard it is to make software. They should have aware how long time needed, how many resources sacrificed by the developer to develop software. In student’s point of view, they need it but they don’t want to give more when people are not giving anything. For example, an antivirus should be bought for some prices, but some students found that there is a forever-renew-trial of the antivirus, so that they don’t have to pay. Along with economic principle, ? with less effort, can gain more? , we don’t want to sacrifice more than others. It became a serious problem. As a conclusion, how to overcome this issue? It is a professional standard, based on the article; Association for Computing Machinery (ACM) stated that any person who wants to join the ACM should accept ? Code of Ethics and Professional Conduct? which covers the ethical issues surrounding oftware piracy. Writer think we can do as ACM do. Article entitled ? The Rules? also stated that computer artifact—both software and hardware—has rules for both its developer and user, so that they will have morally ethical in developing or using software. It has seven rules which allow and avoid both developer and user to do something about the computer artifact. T hese rules should be well-applied as a solution for software piracy issue. In the top of those solutions, human factor is the main factor that we should pay more attention. References: 1. K. W. Miller, Moral Responsibility for Computing Artifacts: ? The Rules?. Illinois: IEEE, 2011. 2. Unknown. (2011). Kode Etik Mahasiswa Fakultas Ilmu Komputer Universitas Indonesia [Online]. Available: http://scele. cs. ui. ac. id/file. php/1434/Kode_Etik_Mhsw_Fasilkom. pdf 3. Thurlow, Max. Ethical Issue in Software Piracy [Online]. Available: http://www. ehow. com/list_6669954_ethical-issues-software-piracy. html 4. Boone, Kevin, Importance of Computer Ethics and Software Piracy [Online]. Available: http://www. ehow. com/facts_5766300_importance-computer-ethics-software-piracy. html How to cite Ethical Issues with the Software Piracy Issue, Essay examples

Friday, December 6, 2019

Integrated Business Experience Home Furnishings

Question: Write about theIntegrated Business Experiencefor Home Furnishings. Answer: Introduction Hermes of Paris was established in 1837 by Thiery Hermes. The company deals in highly luxurious products that are in fashion. It mainly specializes in lifestyle accessories, leather, jewelry, home furnishings, perfumery and ready-to-wear. The company is guided by a brand philosophy that focuses on the product rather image creation. The company was initially focused on serving the European noble people but has grown over time to help all people across the globe. It has collaborated with most of the large enterprises in the world to deliver the best and to reach more customers all over the world (Colino 2010). Organizational Culture of Hermes Organizational culture refers to beliefs and values which dictate the way employees behave in the company. The corporate culture is a strong force, and it governs most parts of people's behavior such as how they act, dress, communicate and the general way of doing their tasks. Hermes, like other multi-national companies, has an organizational culture identified by the seven characteristics. These features are support of innovation, the attention to detail, emphasis on the relationship with people, encouragement of teamwork, being result oriented, rule oriented and employee aggressiveness. All these aspects of organization culture of Hermes have contributed to the growth of the company and also its general business sustainability (Islam et al. 2009). The company has applied these aspects of culture both in Australia and in France; its the home country. To improve, sustain and ensure continuity of the organizational culture, Hermes has come up with specific strategies that have been implemented to achieve. Firstly, the company ensures that new employees are trained for three days to make them feel close to the organization and also understand more about the Hermes organizational culture, values and philosophies. This strategy has been embraced in Australia and other branches of the company outside France. Also, the company doesn't endorse products specifically for Australia, but rather it sells similar products across the world. This significantly promotes oneness and product quality level sustenance in Australia and across the globe. This organization also prepares for a one-day showcasing of products from all its stores. This makes each store to work hard and present the best thus promotional of the organizational culture. This among other strategies has helped Hermes to develop and sustain its organizational culture unlike other organizations (Modaff et al. 2011). Global Corporate Social Responsibility of Hermes Corporate social responsibility refers to the companys aspect of the integration of the concerns of the social life of people and the environmental well-being with a target of improving the interactions of the organization with its stakeholders. Hermes as a multi-national company has shown a lot of concerns about its corporate social responsibility across the globe. The business has put a lot of efforts in conserving the environment and also to support their stakeholders in many ways thus interaction. In 2008, Hermes founded Foundation enterprise Hermes as a body concerned with the corporate social responsibility in Australia and other branches. This body extends the companies concerns to improving the philanthropic support (Warf et al. 2007). The body works in reflection to the organization's core values because the company has embedded corporate social responsibilities in its core values supporting both individual and group's cultural and charity projects. This, therefore, shows that Hermes is hugely committed to the corporate social responsibility both locally and across the globe (Hermes 2010). The Corporate Social Responsibility policy of Hermes promotes and supports the creative arts. It has identified the individual talents or other organizations in creative designs and then supports them both from Australia and in the home country. This organization also supports the traditional crafts. It identifies the persons with the skill and expertise in the traditional arts and helps them in all ways possible. This support is critical in the society, and therefore, the local talent is mentored thus improving the companys interactions with its stakeholders (Eisingerich Ghardwaj 2011, pp 1718). Also, Hermes has promoted education and training. It has supported the establishment of schools and training centers for arts and creative designs. This made the Australians access these educational facilities quickly and hence their growth. Also, Hermes, like any other company concerned with corporate social responsibility conserves the environment. The company prioritizes environmental well-being in its operation. It tries to avoid environmental pollution and is trying to adopt biodiversity and the general green policy (Kock et al. 2012, pp 492-514). Global Competitive Advantage of Hermes Competitive advantage defines the specific conditions that enable a given business organization to produce its products at a lower price or to produce more desirable products to its customers. This helps the business to generate more value to its stakeholders than other competitor firms (comparative advantage) or production of goods that are different from those of the competitors thus they are seen to be superior in the market (Erica 2012). Hermes is a company that has been a market player in Australia for a long time producing distinctly expensive products. The company makes prestige products that are high in price, but of the highest quality in the market. The organization has continuously maintained its unique process of product manufacturing through its handcraftsmanship thus this has guaranteed its product quality such as in the production of its leather bags. This has helped it to maintain the brand name and has already created a perception of its product superiority by the consumers since they derive more value out of this thus their competitive advantage. Good brand image of Hermes in Australia has also helped it to take the best pricing strategies in the market for its benefit. The organization sets the prices for its products basing on how it is conceived, the manufacturing cost and the product in distribution. Company product prices are therefore not influenced by its competitors. Also, Hermes enjoys the competitive advantage in distribution into the market because it already has its roots established in the active fashion market areas. Some of these regions include Japan, France, USA, Asia-pacific regions and Europe. It is, therefore, difficult for other competitors to come in and take the position in these areas to beat Hermes which has a strong brand name in those fashion market areas (Marquis et al. 2013, pp 193243). Conclusion In conclusion, every organization needs to understand and promote a healthy organizational culture since it has a significant influence on the staff and how they perform their tasks. Agencies also need to consider the corporate social responsibility because they improve the interaction with the stakeholders. Besides, businesses should also comprehend the various competitive advantages that they possess. Understanding these concepts is essential for the success of the organization. References Colino, Nadine (2010). The Hermes Scarf: History Mystique. Thames Hudson. ISBN0-500-51518-2. Eisingerich, A. Ghardwaj, G. (2011). "Corporate Social Responsibility: Does Social Responsibility Help Protect a Company's Reputation?". pp 1718. Erica Olsen (2012). Strategic Planning Kit for Dummies, 2nd Edition. John Wiley Sons, Inc Hermes (2010). The Hermes Responsible Ownership Principles, Hermes Pensions Management Ltd. Islam, Gazi and Zyphur, Michael. (2009). Rituals in organizations: A review and expansion of current theory. Group Organization Management. (34), 1140139. Kock, C.J., Santalo J. and Diestre, L. (2012). Corporate Governance and the Environment: What type of Governance creates Greener Companies?'. Journal of Management Studies, Vol. 49, Issue 3, pp 492-514. Marquis, Christopher, Tilcsik, Andrs (2013). "Imprinting: Toward A Multilevel Theory." Academy of Management Annals. Pp 193243 Modaff, D.P., DeWine, S., Butler, J. (2011). Organizational Communication: Foundations, Challenges, and Misunderstandings (2nd Ed.). Boston: Pearson Education Warf, Frederick P. Stutz, Barney (2007). The World Economy: Resources, Location, Trade and Development (5th ed.). Upper Saddle River: Pearson. ISBN0132436892

Friday, November 29, 2019

Shahrukh Khan - the Living Legend free essay sample

His eighth Filmfare Best Actor Award win made him the most awarded Bollywood actor of all time in that category, tied only with actor Dilip Kumar. In 2005, the Government of India honoured him with the Padma Shri for his contributions towards Indian cinema. After graduating with a bachelors degree in economics, he started his career appearing in theatre and several television serials in the late 1980s and later made his Hindi film debut in 1992 with Deewana. Early in his career, Khan was recognised for his unconventional choice of portraying negative roles in films such as Darr (1993), Baazigar (1993), and Anjaam (1994). He later rose to prominence by playing a series of romantic roles in the films Dilwale Dulhaniya Le Jayenge (1995). ,[8] Dil To Pagal Hai (1997), and Kuch Kuch Hota Hai (1998). [9] The commercial success of these films earned him the tag of the King of Romance. [8] Khan then subsequently earned wide critical appreciation for his portrayal of a NASA scientist in Swades (2004), a hockey coach in Chak De! India (2007), and as the titular character in My Name Is Khan (2010). We will write a custom essay sample on Shahrukh Khan the Living Legend or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page 10][11] 12 of the films he has acted in, have accumulated gross earnings of over 100 crore (US$18 million) worldwide,[12][13] making him one of the most successful leading actors of Hindi cinema. [14] Khan is the co-founder of Dreamz Unlimited, a production company and occupies the position of co-chairman of the motion picture production and distribution company Red Chillies Entertainment and the animation studio Red Chillies VFX. He is also co-owner of the Indian Premier League cricket team Kolkata Knight Riders. [15] The year 2007 marked his debut as a television presenter with the Star Plus gaming show Kaun Banega Crorepati. 16] Khan is often labelled by the Media as Brand SRK due to his various brand endorsement and entrepreneurship ventures. He is also a regular stage performer and award ceremony host and has been involved in philanthropic endeavors related to Health care, relief funds and childrens education, for which he was honoured with the UNESCOs Pyramide con Marni award in 2011. [17][18] Khan is considered to be one of the biggest film stars in cinematic history, with a fan following claimed to number in the billions; in 2011, the Los Angeles Times called him the worlds biggest movie star. [19] He has also been regularly featured in the listing of the most powerful names in Indian Cinema and in 2008, Newsweek named him one of the 50 most powerful people in the world. [5] Khan has an estimated net worth of over US $600 million(25 bi llion). [20][21][22][23] He has been married to Indian film producer and interior designer, Gauri Khan since 1991, and together they have two children. Contents [hide] 1 Early life and background 2 Acting career 2. 1 1988–92: Early work and breakthrough 2. 2 1993–97: Critical and commercial success 2. 3 1998–2002: International recognition 2. 4 2003: Spine injury and subsequent surgery . 5 2003–10: Stardom and critical acclaim 2. 6 2011–present: Continuing other ventures 3 Producer 4 Philanthropy 5 Non-film work 5. 1 Television presenting 5. 2 Stage performances 5. 3 Brand SRK 5. 4 Ownership of IPL cricket team 6 Public image 7 In popular media 8 Acting style and analysis 9 Filmography 10 See also 11 Notes 12 Bibliography 13 External links Early life and background Khan was born on 2 November 1965 to Muslim parents in New Delhi, India. [24][25] His father, Taj Mohammed Khan, a Pathan, was an Indian independence activist from Peshawar, British India , present day Pakistan. According to Khan, his paternal grandfather was originally from Afghanistan. [26] His mother, Lateef Fatima, was the adopted daughter of Major General Shah Nawaz Khan of the Janjua Rajput clan, who served in the Indian National Army. [27] Khans father came to New Delhi from Qissa Khawani Bazaar in Peshawar before the partition of India,[28] Regarding his origins, he described himself on Twitter as half hyderabadi (mom) half Pathan (Dad) some kashmiri (grandmom)[29] His father died from cancer when Khan was 15 years old, and his mother died in 1990 after prolonged illness. 30][31] Khan was very attached to his parents as a child and describes their early deaths as a turning point in his life and as his biggest motivation for hard work. He explained that his ideology in life is to make movies so damn bloody big that my parents somewhere sit down on a star and from there also can look at their son and say I can see his movies from here better than I can see the Wall of China or anythin g. We see his movies covering the face of this earth. [32] Khan has an elder sister named Shehnaz. [33] Growing up in Rajendra Nagar neighbourhood of Delhi,[34] Khan attended St. Columbas School where he was accomplished in sports, drama, and academics. He won the Sword of Honour, an annual award given to the student who best represents the spirit of the school. Khan later attended the Hansraj College (1985–1988) and earned his Bachelors degree in Economics. When Hansraj College celebrated its 50th anniversary, it gave away 17 shields to its alumni who had excelled in their lives and professions. Khan was one of them. Though he pursued a Masters Degree in Mass Communications at Jamia Millia Islamia, he later opted out to pursue a career in Bollywood. 35] He also attended the National School of Drama in Delhi. [36] After the death of his mother, Khan moved to Mumbai in 1991. [37] He married Gauri Chibber, a Hindu, in a traditional Hindu wedding ceremony on 25 October 1991. [30] They have two children, son Aryan (b. 1997) and daughter Suhana (b. 2000). According to Khan, while he strongly believes in Islam, he also values his wifes religion. At home, his children follow both religions, with the Quran being situated next to the Hindu deities. [38] Acting career See also: Shahrukh Khan filmography 1988–92: Early work and breakthrough Khan studied acting under the mentorship of theatre director Barry John at Delhis Theatre Action Group (TAG). [39] Khans first starring role was in Lekh Tandons television series Dil Dariya, but due to production delays, the 1988 television series, Fauji was his television debut. He played the leading role of Commando Abhimanyu Rai in the critically acclaimed show, which earned him mass recognition. [37][40] He went on to appear in Aziz Mirzas Circus (1989)[41] and played a minor role in the made-for-television English-language film, In Which Annie Gives It Those Ones (1989). His appearance in these teleserials, led critics to compare his acting style with that of film actor Dilip Kumar. [42] In 1991, Khan shifted base to Mumbai and received his first film offer with Hema Malinis directorial debut Dil Aashna Hai. [37] However, due to production delays, his second film, Deewana (1992), alongside Rishi Kapoor and Divya Bharti released first. [36][43] The film became a box office hit, and launched his career in Bollywood. [44] Despite portraying a supporting character in the film, he won a Filmfare Best Male Debut Award, the following year. He subsequently featured in Mani Kauls adaptation of Fyodor Dostoevskys The Idiot, Idiot. Originally made for television, the film eventually received a theatrical release and debuted at the New York Film Festival on 8 October 1992. [45] Later that year, he played the titular character in the comedy, Raju Ban Gaya Gentleman, which was his first of many collaborations with actress Juhi Chawla. The film proved to be a box office hit. [46] He went on to star in Ketan Mehtas Maya Memsaab, an adaptation of Gustave Flauberts novel Madame Bovary. Upon release, the film generated controversy in India due to Khans appearance in an explicit sex scene with co-star Deepa Sahi. [47] 1993–97: Critical and commercial success In 1993, Khan garnered appreciation for portraying negative roles, that of an obsessive lover and a murderer, respectively, in the box office hits, Darr and Baazigar. [48] The Encyclopedia of Hindi Cinema analyzed that he defied the image of the conventional hero in both these films and created his own version of the revisionist hero. [49] Darr marked the first of many collaborations of Khan with film-maker Yash Chopra and his banner Yash Raj Films. Khans stammering in the film and the usage of the phrase, I love you, Kkkiran, were popular with the audiences. [50] His other release, Baazigar, in which he played an ambiguous avenger who murders his girlfriend, shocked the Indian audiences with an unexpected violation of the standard Bollywood formula. [51] His performance in Baazigar won him his first Filmf are Best Actor Award. The same year, Khan played the role of a love-struck musician in Kundan Shahs dramedy Kabhi Haan Kabhi Naa, a performance that earned him a Filmfare Critics Award for Best Performance. In a retrospective review by Rediff, Sukanya Verma called it Khans best performance and added, He was spontaneous, vulnerable, boyish, mischievous and acting straight from the heart. [52] Khan, himself, considers this film to the best film that he has acted in. [53] In 1994, Khan once again played an obsessive lover in Anjaam, co-starring Madhuri Dixit. Though the film was a commercial failiure, Khans performance earned him the Filmfare Best Villain Award. [54] Khan, holding a painting of his character Raj Malhotra from Dilwale Dulhania Le Jayenge(1995) that was gifted to him during an appearance on a TV show. In 1995, Khan starred in two box-office blockbusters. His first release was Rakesh Roshans melodramatic thriller Karan Arjun, in which Khan was a part of an ensemble cast that included Salman Khan, Kajol, Mamta Kulkarni, Raakhee and Amrish Puri. The film, which dealt with the concept of reincarnation, became the second-highest grossing film of the year in India. 55] He followed it with Aditya Chopras directorial debut, the romance Dilwale Dulhania Le Jayenge. A major critical and commercial success, the film became the years top-grossing production in India and abroad. [56] The film was declared an all time blockbuster; it remains the longest-running film in the history of Indian cinema[57] and as of 2011, it is still playing at the Maratha Mandir theatre in Mumbai. [58] Dilwale Dulhania Le Jayenge has grossed over 1. 2 billion worldwide. The film won ten Filmfare Awards, and Khans performance as a young NRI who alls for Kajols character while on a trip across Europe won him critical acclaim and his second Best Actor Award at the Filmfare. In 2005, Indiatimes Movies ranked the film amongst the 25 Must See Bollywood Films, citing it as a trendsetter of sorts. [59] Raja Sen reviewed, Khan gives a fabulous performance, redefining the lover for the 1990s with great panache. Hes cool and flippant, but sincere enough to appeal to the junta [audience]. The performance itself is, like the best in the business, played well enough to come across as effortless, as non-acting. [60] 1996 proved to be a disappointing year for Khan, as he appeared in two critical and commercial failiures, Praveen Nischols English Babu Desi Mem and Mahesh Bhatt Chaahat[61] However, in 1997, his starring role in Subhash Ghais social dram a Pardes earned him commercial success. The film, which also featured Mahima Chaudhry and Apurva Agnihotri, saw him portray the role of Arjun, a musician facing a moral dilemma. His performance earned him a nomination for the Best Actor at the Filmfare Award ceremony. He then featured in Aziz Mirzas romantic comedy, Yes Boss, opposite Juhi Chawla. Upon release, the film performed moderately well at the box-office. [62] His final release of the year was Yash Chopras blockbuster musical romanance, Dil to Pagal Hai. The project, also featuring Madhuri Dixit and Karishma Kapoor, marked his second collaboration with the filmmaker. Khan essayed the role of Rahul, a stage director who falls in love with one of his new actresses, played by Dixit. The film as well as his performance met with critical appreciation; he won his third Best Actor Award at the Filmfare. [62] 1998–2002: International recognition In 1998, Khan appeared in three films. His first release was Mahesh Bhatts action comedy, Duplicate opposite Juhi Chawla and Sonali Bendre. The film, which saw him portray a double role, marked his first of many collaborations with Yash Johars production company, Dharma Productions. The film however, failed to do well at the box office. [63] He then won critical praise for his performance in Mani Ratnams acclaimed Dil Se The film was the third in Ratnams trilogy of terror films that depict human relationships against a background of Indian politics, after Roja (1992) and Bombay (1995). 64][65] Khan played the part of Amarkant Amar Varma, an All India Radio correspondent, who develops an infatuation for a mysterious terrorist, played by Manisha Koirala. [66] Rediff. com published, Khan delivers a compelling performance. He plays the part with taut restraint, and expresses exasperation superbly. [67] The film,which failed financially in India, however, emerged as a commercial success overseas,[68] becoming the first Indian film to enter the top 10 at the United Kingdom box office. [69][70] His final release of the year was Karan Johars candyfloss romance, Kuch Kuch Hota Hai, which paired him with Kajol and Rani Mukerji. The film was declared an all time blockbuster, with a worldwide gross of over 1 billion. [71] Khan played the role of Rahul Khanna, a college student, who falls in love with his best friend, Anjali(Kajol) after the death of his wife, Tina( Rani Mukerji), years after breaking contact with her. His performance won him the Best Actor award at the Filmfare ceremony for the second consecutive year. Khans only release in 1999, Baadshah opposite Twinkle Khanna, was an average grosser, for which he earned a Filmfare Award nomination for Best Performance in a Comic Role. 72] In the same year, Khan set up his own production company, Dreamz Unlimited with actor, Juhi Chawla and director, Aziz Mirza. (see below). In 2000, the three collaborated on their first film, Phir Bhi Dil Hai Hindustani. The film opened to mixed reviews from critics and audiences alike and failed to emulate the commercial success of the trios previous films, Raju Ban Gaya Gentleman and Yes Boss. [73] Khans next release was Mansoor Khans action drama Josh. The film starred Khan as the leader of a Christian gang in Goa, with Aishwarya Rai playing his twin sister. The film emerged as a box office success in both India and abroad. [73] Vinayak Chakravorty of Hindustan Times wrote that Khan basks in his tailormade role, donning with panache the garb of a streetsmart tough. [74] He next played the role of a Muslim archaeologist, beaten to death during the unrest following the partition of India in Hey Ram. Directed by and co-starring Kamal Hassan, the film was critically acclaimed and was selected as Indias entry for the Best Foreign Language Film at the Oscars that year. [75] Additionally, for the Tamil version of the film, Khan dubbed for his own lines. 76] His final release of the year was Aditya Chopras romantic drama, Mohabbatein, co-starring Amitabh Bachchan. The film was a major financial success, and Khans performance as a music teacher was acclaimed by critics; Taran Adarsh of Bollywood Hungama mentioned him to be outstanding as Raj Aryan. He was awarded his second Filmfare Critics Award for Best Actor for his performance in the film. I n 2001, Khan produced and essayed the titular role in Santosh Sivans historical epic, Asoka, a partly fictionalised account of the life of Ashoka the Great. 77] The film was screened at the Venice Film Festival and the 2001 Toronto International Film Festival to a positive response. [78] The film, which also featured Kareena Kapoor received generally positive reviews with Khan receiving favourable reactions for his performance; Rediff concluded that he puts in a strong performance, in this well defined role. [79] He next collaborated with Karan Johar again in the family drama, Kabhi Khushi Kabhie Gham, in which he featured as a part of an ensemble cast that included Amitabh Bachchan, Jaya Bachchan, Kajol, Kareena Kapoor and Hrithik Roshan. The film was a major financial success in India and the top-grossing Indian production of all-time in the overseas market until 2006, earning over 1. 17 billion worldwide. [80] Khans portrayal of Rahul Raichand, an adopted son of Bachchans character, who disowns him for marrying a girl belonging to a lower socio-economic group than his family, played by Kajol, met with wide public appreciation. Khan described the character of Rahul by saying, I love the vulnerability and the honesty in his eyes. He has the appeal of a boy next door. Besides, his intensity and ability to convey emotions without words is amazing. [81] Taran Adarsh reviewed, Khan sparkles yet again, noting that he performed the part with amazing poise, class, honesty and maturity. [82] It garnered him another nomination for the Filmfare Best Actor Award. Khan termed Kabhi Khushi Kabhie Gham as a turning point in his career. [81] In 2002, Khan played the titlular role, The role of Devdas in Sanjay Leela Bhansalis period romance, Devdas, which was the most expensive Bollywood film ever made at the ti

Monday, November 25, 2019

Free Essays on Effects of Trust in Management

Introduction A few weeks ago, I was watching the evening news with a friend of mine. A breaking story came on announcing Arthur Anderson’s use of unethical accounting practices in the Enron scandal. I asked Shannon if she knew anything about the firm’s involvement, and she said in disbelief that she had not. The interesting fact here is that Shannon works for Anderson Consulting. In that moment, she lost all trust in the company and is now looking for a new job. Trust plays a pivotal role in every corporation’s daily activities; it can be a specific management tactic, or a mediating variable in a work team. Increased trust between managers and subordinates will lead to increased productivity and job commitment. However, this type of persuasive discourse is often very difficult to consciously achieve because of the numerous factors involved. This paper will address contemporary ideas on establishing trust in organizations, its effects and includes an informal study on the use of managerial trust. Literature Review Over the past few years, the topic of trust in management has received much scholarly attention. The fall of Enron and other such recent scandals where hundreds of employees lost their jobs may explain this. As Caudron (1996) explains it, â€Å"Management has lost all credibility, employees are scared, and organizational trust has hit rock bottom.† An article by Ellen Whitener et al. (1998) explores the many practices managers must engage in to gain employee trust. She begins by defining managerial trust in three facets. First, trust relies on the trustor’s belief that the trustee will act benevolently. Second, trust relies on the concept that risk is involved. Third, there is some degree of dependency in the relationship (Whitener, p. 513). Here, trust is viewed as an attitude the trustor has about the trustee. Whitener uses two theories to analyze the motivation behind trust strategies, agen... Free Essays on Effects of Trust in Management Free Essays on Effects of Trust in Management Introduction A few weeks ago, I was watching the evening news with a friend of mine. A breaking story came on announcing Arthur Anderson’s use of unethical accounting practices in the Enron scandal. I asked Shannon if she knew anything about the firm’s involvement, and she said in disbelief that she had not. The interesting fact here is that Shannon works for Anderson Consulting. In that moment, she lost all trust in the company and is now looking for a new job. Trust plays a pivotal role in every corporation’s daily activities; it can be a specific management tactic, or a mediating variable in a work team. Increased trust between managers and subordinates will lead to increased productivity and job commitment. However, this type of persuasive discourse is often very difficult to consciously achieve because of the numerous factors involved. This paper will address contemporary ideas on establishing trust in organizations, its effects and includes an informal study on the use of managerial trust. Literature Review Over the past few years, the topic of trust in management has received much scholarly attention. The fall of Enron and other such recent scandals where hundreds of employees lost their jobs may explain this. As Caudron (1996) explains it, â€Å"Management has lost all credibility, employees are scared, and organizational trust has hit rock bottom.† An article by Ellen Whitener et al. (1998) explores the many practices managers must engage in to gain employee trust. She begins by defining managerial trust in three facets. First, trust relies on the trustor’s belief that the trustee will act benevolently. Second, trust relies on the concept that risk is involved. Third, there is some degree of dependency in the relationship (Whitener, p. 513). Here, trust is viewed as an attitude the trustor has about the trustee. Whitener uses two theories to analyze the motivation behind trust strategies, agen...

Thursday, November 21, 2019

Understanding Practical Business and Organizational Research Assignment

Understanding Practical Business and Organizational Research - Assignment Example The study elucidates the huge problem of poor performance, accountability, and transparency in the government institutions such as municipalities. The Americans have expressed their dissatisfaction of the delivery of services in the government institutions. On the other hand, the purpose of the study was to evaluate the contribution of performance measure to the sustainable improvement, accountability, and transparency of the government organization (Sanger, 2012). The research hypothesized that cities that had sophisticated performance measurement systems would have a high likelihood of using the performance data to improve performance. However, the research did not have research questions. The study used an analytic approach to collect quantitative data from a sample of 190 cities. The researchers searched the cities with a high likelihood of measuring performance with the intent of improving service delivery (Sanger, 2012). Fundamentally, the researchers selected a sample from four service areas namely police, parks and recreation, fire, and public works. The study used quantitative approaches to analyze the data and present it in tables. The study findings are important for the city mayors and officials who hold leadership positions to implement the information gotten from performance measurement for the betterment of services. In summary, the researchers established that government institutions rarely implement the information from performance measurements for the improvement of services. The data analysis indicates that few organizations use the information to improve service delivery. The analytic approach used in this study can be applied to solve performance problems. The researchers have analyzed the problem by seeking the primary data of the various cities. Primary data establishes the main cause of a problem, and thus provides a platform for selecting the best solution (Zikmund, 2013). For

Wednesday, November 20, 2019

John Wycliff's contribtions to the christian religion Term Paper

John Wycliff's contribtions to the christian religion - Term Paper Example Other individuals believed in giving out offerings so that they can receive forgiveness for their sins (McDonald 139). John Wycliffe acquired his college education at Morten College at Oxford, which acted as a fundamental tool in his career. This is becoming a significant and reputable icon towards building Christian faith. During Wycliffe’s time, the church had a dominant force in almost all areas of life. The church utilized its power to exploit fellow Christians in a variety of ways. For instance, Christians were to pay for their sins whereby mode of payment was money or gifts meant for the ministers (Phillips 26). Most people were in bondage of the church and its sacraments based on how it expressed and ensured its power manipulated Christians. This prompted Wycliffe turned out to be the then fearless critical of the church’s abuse of power (Davis 98). Hence, becoming popular due to his stern stand and criticism on the church though he based his arguments on the word. The then secular government was an example of a reputable organization that boosted and sided with him in its quest to reveal how the church had become and taken advantage of its congregation’s ignorance. Government’s support was in form of preventing the church from directly condemning the emergent critic whose arguments were justifiable besides the church some of the dealings being unbiblical. Wycliffe was also a significant workforce in the reformation of the church. During his time, the church seemed own a large area of England besides having an unconquerable influence (Lavinsky). Instances of corruption characterized the mainstream church more so the clergy taking advantage of the ignorant faithful. In addition, the clergy contrary to what their vows stated proved to be immoral besides sometimes allowed to pass certain stages without accomplishing the required measures, hence the church during then producing illiterate priests (McDonald

Monday, November 18, 2019

Urban Studies and Planning Essay Example | Topics and Well Written Essays - 1000 words

Urban Studies and Planning - Essay Example All these careers are exciting and personally fulfilling in the sense that they are well paying, challenging, and they give one an opportunity to grow. The urge of using my skills to establish a community where people can live and start families makes a career as an urban planner to be my first priority. I understand that a college degree in addition to extensive training is a requirement for a successful entry into this field of work. To qualify as an urban planner, one needs to take classes on environmental studies so as to understand the interactions between people and the natural environment as well as the dynamics of the environment. Moreover, a person needs to take classes on economics so as to comprehend how the markets operate, particularly, what makes a successful regional economy and business. Additionally, one needs to take classes in art and design so as to prepare oneself to think creatively about visual appearances. The prospect of getting employed as an urban planner is also high. First, there are many institutions, both public and private that hire urban planners. With a degree in urban planning together with the required experience, I can be hired by local/regional governments, private planning firms, and private property owners to facilitate the planning of commercial and communal developments, as well as transportation systems and public facilities (Bayer, Frank, & Valerius, 2009). Secondly, urba n planning is a growing field of employment. As Bayer, Frank & Valerius (2009) put it, the roles of urban planners remain in high demand, and is expected to grow significantly by 2014. For example, the U.S News and Urban Report rated urban and regional planner among the best careers in 2009 (U.S News, 2009). Additionally, the Bureau of Labor Statistics projects a 15% growth in planning jobs between 2006 and 2016. The salary and benefits of regional and urban planners is very attractive. The Bureau of Labor Statistics indicates that the median yearly pay for urban and regional planners was $63,040 in May 2010 (Bureau of Labor Statistics, 2013). Based on the fact that the planning industry has experienced growth in the past years, the prospect of career development is also looking good. This growth is stimulated by environmental concerns and population growth being experienced. Other than becoming an urban planner, I would prefer to become an architect. Since my childhood, I have alwa ys been fascinated with the science and art of building and construction. The prospect of becoming a renowned architect is exciting and interesting because this career path will enable me to design an entire built environment- from how a building associates with its surrounding environment, to construction or architectural details that entails its interior and designing and making furniture to be used inside it. Looking at this career path from a different perspective, I established that architecture is poetic in the manner that it presents itself. It is complex in the questions and issues it gives rise to. Contrary to popular belief that architecture is static, I have established that architecture is detailed and analytical. These qualities make this career path not only attractive, but also fulfilling. A career in architecture is interesting and exciting due to its longevity nature. As compared to most professions, architects can practice their

Saturday, November 16, 2019

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in Cercospora Introduction The quinone outside inhibitor (QoI) or Strobilurin is one of the most important fungicides used to control fungal and some Oomycetes pathogens in agricultural crops. This class of fungicide was first isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, are available which are more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients: azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (Bartlett et al., 2002; Vincelli, 2012). QoI fungicides exhibit both translaminar (across leaf blade) and weak systemic movement within the plant. All QoI fungicides have the same mode of action which disrupt mitochondrial respiration and prevent energy production inside fungal cells (Vincelli 2012). The disruption of ATP generation occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron transport from cytochrome b to cytochrome c1 (Bartlett et al., 2002). QoI fungicides are applied to control a broad range of plant pathogens including fungi, water molds, downy mildews, powdery mildews and rusts (Vincelli, 2012). They are mainly used as protective and curative fungicides because of effective action against spore germination and penetration (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). More than 50 species of plant pathogens resistant to QoI fungicides has been reported and there is a high risk of selecting resistant isolates in the field (Fungicide Resistant Action Committee, 2013). Three different point mutation in mitochondrial cytochrome b gene has been associated with resistant mechanism against QoI fungicide. The primary mechanism of resistance is by amino acid substitution from glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point mutation at cytochrome b gene is the substitution of phenylalanine with leucine at po sition 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernà ¡ndez-Ortuà ±o et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. Alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003). Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a single cell. The coexistence of wild and mutated alleles in QoI resistant/sensitive locus has been reported in several other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007; Villani and Cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection pressure and vice versa (Fraaije et al., 2002; Ishii et al., 2007). The main objectives of this study are to i) identify heteroplasmy in Cercospora sojina; ii) monitor the proportion of resistant and sensitive allele in the presence of selection pressure in the laboratory; and, iii) study the sensitivity of C. sojina against azoxystrobin. Materials and Methods Isolate selection and development of single spore cultures Isolates of C. sojina were screened for resistant and sensitive allele using Taqman assay. After screening, three isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, plated were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to new V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. Radial growth study A total of two isolates: 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide sensitivity and radial growth study. Four different concentrations of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i.; Syngenta Crop Protection) was used to make 100,000  µg a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks: 10,000, 1000, 100 and 100  µg a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01  µg a.i./ml) by adding 1ml of respective fungicide stock in 1 liter of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60  µg a.i./ml. Two straight line at 90o were drawn at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three generations. Taqman assay and Sanger sequencing The G/C point mutation in cytochrome b gene will be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. Threshold cycle or Ct of two dyes will be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample. Sanger sequencing will be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward: 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse: 5 TAATACAGCTTCAGCATTTTTCTTCT 3 ) will be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25  µl consisting of 1.25  µl (10  µM) of each primer, 12.5  µl of 2x Veriseq PCR mix (Enzymatics Inc.), 1.25  µl DNA and 8.5  µl water and run in following settings: initial denaturation at 94 ° C for 2 min followed by 29 cycles of denaturation at 94 ° C for 20 s, annealing at 55 ° C for 25 s, extension at 72 ° C for 1 min and final extension at 72 ° C for 10 min. Data analysis Sequences derived from Sanger sequencing will be aligned to publicly available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations. The percent growth inhibition will be calculated as: ([colony diameter on control media 5 mm] [colony diameter on fungicide amended media 5 mm]) / ([colony diameter on control media 5 mm]) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically. Expected results This study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the extent of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measurement of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure. References Anesiadis T, Karaoglanidis G and Tzavellaà ¢Ã¢â€š ¬Ã‚ Klonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(11à ¢Ã¢â€š ¬Ã‚ 12):647-651. Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4):441-451. Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Parrà ¢Ã¢â€š ¬Ã‚ Dobrzanski B. 2002. The strobilurin fungicides. Pest management science 58(7):649-662. Fernà ¡ndez-Ortuà ±o D, Torà ©s JA, De Vicente A and Pà ©rez-Garcà ­a A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1):1-9. Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative alleleà ¢Ã¢â€š ¬Ã‚ specific realà ¢Ã¢â€š ¬Ã‚ time PCR measurements with the fluorescent dye SYBR Green I. Plant pathology 51(1):45-54. Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http://www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4. Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosis of QoI resistance in cucumber and eggplant fungal pathogens. Phytopathology 97(11):1458-1466. Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and practical resistance to trifloxystrobin. Phytopathology 104(9):945-953. Vincelli P. 2012. QoI (Strobilurin) Fungicides: Benefits and Risks. The Plant Health Instructor. DOI: 10.1094/PHI-I-2002-0809-0. Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and related fungicides acting at the Qo site of complex III. Pest management science 59(5):499-511.

Wednesday, November 13, 2019

United States Involvement in The Second World War (WWII) Essay

World War II   Ã‚  Ã‚  Ã‚  Ã‚  As totalitarian sates emerged into power, the United States got involved with World War II to help control these groups and to promote democracy in the European theatre of the world. The party with the most power at the time was the Nazi Party, led by Adolf Hitler. This socialist party was led by a powerful dictator who broke away from the League of Nations and began to conquer vast amounts of territory at a fast rate. The United States wanted to leave foreign affairs alone in fear of another world war. The United States could not avoid the fact Hitler was taking over Europe and help was needed. The United States became fully involved in the European theatre of World War II when Hitler led his armies on a series of blitzkrieg’s, taking over Denmark, Norway, Belgium, Holland, northern France, and by breaking the Nazi-Soviet pact.   Ã‚  Ã‚  Ã‚  Ã‚  The United States, under the presidency of Franklin D. Roosevelt, wanted to remain neutral and wanted to stay out of foreign affairs. People like Lindbergh strongly opposed any aid to foreign affairs, but Roosevelt felt American security and Democracy was in jeopardy if no help was given. As Hitler began his campaigns in Europe, especially in Poland, the United States sent aid to France and Britain to resist the Nazi’s. Germany defeated Poland and easily took over weaker countries, sometimes without Keith 2 firing a single shot as in Czechoslovakia. The United States remained...